                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-20.00 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-13.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTCTCGAAGCAGCCGGCCTGAATTTCGCTGGCATGTCGCCGGACGGCGTTTTGCCGG
AAACGGTCGAATATGCGGATCATCCTTGGTTTATCGGCGTGCAGTACCATCCGGAACT
GAAATCCCGTCCGTTTGAGCCGCATCCGCTTTTTGCATCCTTTATCGAAGCGGCCATC
GAACAGAGCCGTCTGGTCTGAgtttgagcgcgcccttcggggcgcgttttgtttatgcgtcttgttttcgatgactatggatgcc
agatacagcccattctggcgtttataaattgaggttccgctATG

    BMEI0850 Gene: BMEI0850     GI: 17987133     BI number: BMEI0850     GOG: COG2877     Description: 2-DEHYDRO-3-DEOXYPHOSPHOOCTONATE ALDOLAS   T T  T T  T CG GC |  A       TC |  T      G  T |  C       CG |  C       CG |  T      |  T |  T       GC |  T       AT |  A      G  G |  T      A  A C  C       Cg CG        At TA        At A  A       Gt CG        Cg GC        Ta CG       |  g       tc CG       |  c      t  g GC       A  g       cg |  C      C  c       cg |  A       Cg        cg AT        Gc        gc GC        Gc        cg TG       C  |       gc TA        Gc        cg TA        At        gt GC        At        at                         ttgtttatgcgtcttgttttcgatgactatggatgccagatacagcccattctggcgtttataaattgaggttccgctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2877 3-deoxy-D-manno-octulosonic acid (KDO) 8-phosphate synthase ... can be seen here     ..................................................................................................................