                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -7.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -4.71 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -7.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCTCTTTCTGAATTCTGTCCGCAAGCAGAAGATTTCTCTAACGATCTTCCTTATCAA
TGGCGTGAAATTGACCGGCATTGTAACGTCTTTCGATAATTTCTGCGTGCTTCTGCGT
CGTGATGGTCATTCGCAGCTTGTTTACAAGCATGCTATTTCGACAATCATGCCGAGCC
AGCCTGTACAGATGTTTGAAGGCGAGGAAGCCTGAcgctttccgatatttgccggggcgtggtaagtatcccgc
cccagcttttgtttgagtatgtttcggccagaaagcgcatcgctatcgggcaTTG

    BMEI0873 --- BMEI0874 Gene: BMEI0873     GI: 17987156     BI number: BMEI0873     GOG: COG2262     Description: GTP-BINDING PROTEIN HFLX Gene: BMEI0874     GI: 17987157     BI number: BMEI0874     GOG: COG0740     Description: ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNI GT T  A       CT T  A      G  T A  C      T  C CG        GT GT        CG GC        GC C  T      T  | C  T      C  | AT       T  | GC       T  | TG       T  | TA       A  |        G AT       A  |      T  G |  A       TG       A  T |  A       AT        GC |  T       GC        TA AT        CG        GT AT       T  T      C  T GC       T  |      T  | |  T      T  |       GC TG        CG        CG GC        TA        GC CG        GT        TA GT        CG        CG                         CTTGTTTACAAGCATGCTATTTCGACAATCATGCCGAGCCAGCCTGTACAGATGTTTGAAGGCGAGGAAGCCTGAcgctttccgatatttgccggggcgtggtaagtatcccgccccagcttttgtttgagtatgtttcggccagaaagcgcatcgctatcgggcaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2262 GTPases ... can be seen here [OU] COG0740 Protease subunit of ATP-dependent Clp proteases ... can be seen here     ..................................................................................................................