Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:46 nt.    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:13 nt. Size=49 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-25.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaca-caggat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggacatcaaagaattcgccttccaggattgagcgcatattgagccagtcctgtaaggtgaacattctagtttctggttatggacgcagttgcgcctgac
ctttcttttggaaagcgccccttgtctggacgaagacgtgtggaaaaggtgcgtgcaagacccggagtaagttttcgATG

    BMEI0880


Gene: BMEI0880     GI: 17987163     BI number: BMEI0880     GOG: COG0629     Description: SINGLE-STRAND BINDING PROTEI


  a
t  t
 at
 cg
g  a       tc
 cg       t  t
 gc       a  a
a  |       cg
 gc        at
 ta        at
 tg        gt
 at       t  |
 gc        gc
 gc        gt
 at       |  g
 cg       a  g
c  t      a  t       gt
 ta       t  t      a  t
 ta       g  a       cg
 cg       t  t       gc
 cg        cg        cg
 gt        cg       a  |
 cg        ta        gc
 ta        gc        gc
|  a      |  g      t  |
|  c      a  c       at
 ta       c  a       tg
 at        cg        ta
 at        gt        gc
 gc        at        gc
                        tttcttttggaaagcgccccttgtctggacgaagacgtgtggaaaaggtgcgtgcaagacccggagtaagttttcgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0629 Single-stranded DNA-binding protein ... can be seen here

    ..................................................................................................................