                                                                        Gene putatively regulated by attenuation in B_melitensis_I

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=3 nt.   Size=19 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCTTGCGTGACGGCACCGACCTTGATTACGAAATGCAGATGGCTGGCATGAACGGC
ACCATGGCGCCGGAATTGCAGACGGTTTTTCTACCTGCCGATCCGGCAGTGCGCACGA
TTACCGCCACATTGGTTCGCCAGATTGCGTCCATGGGCGGGGACATCAAGCCCTTCGT
TCCGGTGGCCGTCGCTGCCGCCTTGAACACCAAATTCAAATCCTGAccgcagggagtttttcgatc
atgtctttcattcgctcggcgctggccgctgccgcttttgtcgcgctctcgatcggtgcaGTG

    BMEI0887 --- BMEI0888 Gene: BMEI0887     GI: 17987170     BI number: BMEI0887     GOG: COG0652     Description: PEPTIDYL-PROLYL CIS-TRANS ISOMERASE Gene: BMEI0888     GI: 17987171     BI number: BMEI0888     GOG: COG0652     Description: PEPTIDYL-PROLYL CIS-TRANS ISOMERASE cc A  g        a Gc       c  t Ta        tg Cg        at Cg        gc T  |      c  t A  |      t  t A  |      t  t A  |      t  c Cg       t  | Ta        ta Tg        gt At        at At        gc At       g  g       ct C  |       gc       g  g C  |       at        cg A  |      c  |       gc C  |       gc        gc At        cg        cg At        cg       |  c Gc       A  |      t  t Tg        Gc        cg Ta        Tg        gc                         cgcttttgtcgcgctctcgatcggtgcaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0652 Peptidyl-prolyl cis-trans isomerase (rotamase) - cyclophilin family ... can be seen here [O] COG0652 Peptidyl-prolyl cis-trans isomerase (rotamase) - cyclophilin family ... can be seen here     ..................................................................................................................