                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:7 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.60 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-22.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGCGGCTGATGCTGCACTTCATCGAGAAGGCGCAATTGGTACAGGCCCTGCGCAGC
CACGACTGGCCCGGTTTCGCGCGCCGCTATAATGGCCCCGCCTTTACCCGCAACAATT
ACGACAAGCGCATGGCTGAGGCACATCAACGCTGGCAAAACCAGATTGGCAGTTTTAA
AAAAGCAGCCTGAtacatcccgtctccggcggtggacaaaccgccaccggggatttaaatcgatttataaggatgaagcgcccctatgcgg
actgcatcggcgcttcatccatttgttctgaagccTTG

    BMEII0009 Gene: BMEII0009     GI: 17988353     BI number: BMEII0009     GOG: COG0800     Description: 4-HYDROXY-2-OXOGLUTARATE ALDOLASE / 2-DEHYDRO-3- DEOXYPHOSPHOGLUCONATE ALDOLAS            ta           t  t           t  a        a           a  a      g  c           g  g      g  t   a        cg        cg c  a       ta        gc a  a       at        ta gc       a  g       at gc       a  a      t  c tg       t  a      c  | gc       t  g      c  | gc       t  c       cg c  a      a  g       cg gc        gc        gc gc        gc        cg cg        gc        gc cg        gc        at tg       c  t       at cg       c  a       gc ta        at        ta gt        cg        at                         ccatttgttctgaagccTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0800 2-keto-3-deoxy-6-phosphogluconate aldolase ... can be seen here     ..................................................................................................................