                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:168 nt.     Distance to run of Ts=3 nt.   Size=27 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.16 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcgttaccgaatggcgaaattaggccaccggggccatcacattaaatgtctttcccttaagggtgttgatccaaatttacttctttgtgctcctccggc
cccccattcatggctcggccggcgattttgtcaatcgccgtgccatggtaaactaaatgctaacctgcatgctttagaaacccataaagagaccgtcata
ttttcaacataggattgtatcgtagacttcctgcaaccatgtaagcgcgatgatgaatggcgaaacggacaggaagacgattgcagaagggaaacacaga
ATG

    BMEII0024 Gene: BMEII0024     GI: 17988368     BI number: BMEII0024     GOG: COG2951     Description: MEMBRANE-BOUND LYTIC MUREIN TRANSGLYCOSYLASE   a        ct t  a      t  t ta       t  t at        cg cg        at at        tg c  c      t  c t  t      t  t a  t      a  c c  t      a  c       tc c  |      a  t      t  a gc       c  c       at gc       c  |       cg gc       t  |       cg gt       a  |      |  c |  t       gc       c  t |  a       tg       c  c |  a       tg        cg |  g       gc        cg cg       t  |       gc cg        gc        gc at        gc        cg cg        gc        cg                         cgattttgtcaatcgccgtgccatggtaaactaaatgctaacctgcatgctttagaaacccataaagagaccgtcatattttcaacataggattgtatcgtagacttcctgcaaccatgtaagcgcgatgatgaatggcgaaacggacaggaagacgattgcagaagggaaacacagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2951 Membrane-bound lytic murein transglycosylase B ... can be seen here     ..................................................................................................................