Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-16.50 kcal/mol
Antiterminator: Size=25 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGATTTCTTCACGCGATAAttgcatctggcggctcatacagcccgccgaatgaagccacatatgcgtcatgtatacatccgta
tatgtcttataccacaatgcaccagcatatcagcctcgcggcgtctggcaggggctaaatgcttctgctaaagaccttttgtcgggcaaagatcccgcaa
atcacaggaaacaaccatgtccagcgacagtagtcgaaaaaaattgccgctgaggatgcccttctagagcccgttgctctcgcccggcatccgatgcggc
gccgagaggtgagatATG

    BMEII0058


Gene: BMEII0058     GI: 17988402     BI number: BMEII0058     GOG: -------     Description: hypothetical protei


            a
          a  a
          t  t
           cg
  c        gc
t  t       gt
g  g       gt
 cg        gc
 gc        at
g  a       cg
c  |       gc
g  |       gt
 cg       |  a
 tg       |  a
 cg        ta
 cg        cg
 gc        ta
 at        gc
            cttttgtcgggcaaagatcccgcaaatcacaggaaacaaccatgtccagcgacagtagtcgaaaaaaattgccgctgaggatgcccttctagagcccgttgctctcgcccggcatccgatgcggcgccgagaggtgagatATG


    ..................................................................................................................