                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-16.50 kcal/mol
Antiterminator: Size=25 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGATTTCTTCACGCGATAAttgcatctggcggctcatacagcccgccgaatgaagccacatatgcgtcatgtatacatccgta
tatgtcttataccacaatgcaccagcatatcagcctcgcggcgtctggcaggggctaaatgcttctgctaaagaccttttgtcgggcaaagatcccgcaa
atcacaggaaacaaccatgtccagcgacagtagtcgaaaaaaattgccgctgaggatgcccttctagagcccgttgctctcgcccggcatccgatgcggc
gccgagaggtgagatATG

    BMEII0058 Gene: BMEII0058     GI: 17988402     BI number: BMEII0058     GOG: -------     Description: hypothetical protei             a           a  a           t  t            cg   c        gc t  t       gt g  g       gt cg        gc gc        at g  a       cg c  |       gc g  |       gt cg       |  a tg       |  a cg        ta cg        cg gc        ta at        gc             cttttgtcgggcaaagatcccgcaaatcacaggaaacaaccatgtccagcgacagtagtcgaaaaaaattgccgctgaggatgcccttctagagcccgttgctctcgcccggcatccgatgcggcgccgagaggtgagatATG     ..................................................................................................................