Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=3 nt.   Size=19 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-17.00 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCTGCACCAGATCTTCGGCTTCCGAAACTCTGCCGCCGAAAAGCCGCCGAACGAAAT
AGGCTTTCAGGAGACGCGAAAGCTCTTCAAGCAGCGTCCGGTAAGCCGCACTATTTCC
ATCCAGCGCCAACAACATCAGGGCCTTCAACCTCTCTTCATTAGAACGGGCCAGTCTC
GTTTCTCCTGTCGTCTTATTCGCGATAGGGACGAAAAAGGTTACATCCGCATCCCGAG
CGATCACatcggcgtgaacgatgtaacctttttcccctatccagcgaaacccttcctgtcacgcgccgATG

    BMEII0073


Gene: BMEII0073     GI: 17988417     BI number: BMEII0073     GOG: NOG14731     Description: hypothetical protei


           AC
          T  A
          T  T
           GC
           GC
          A  G
          A  C
  A       A  A
T  T      A  |
T  T      A  |
C  C      G  |
 TG       C  |
 GC        AT
 CG        GC
 TA        GC
 GT        GC
 TA       A  G
 CG       T  A
 CG       A  |
T  |      G  |
C  |       CG
T  |       GC
 TG        CG
 TA        TA
 GC       T  T
 CG       A  C        t
 TA       T  A      g  g
C  A      T  C      c  a
T  A      C  a      g  a
G  A      T  t       gc
A  A       Gc        cg
 CG        Cg        ta
 CG        Tg        at
 GT        Gc        Cg
 GT        Tg        At
                        aacctttttcccctatccagcgaaacccttcctgtcacgcgccgATG


    ..................................................................................................................