                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTGGTCCATGTGAACACCTATGGTGGGGCCGACAACACGGTTCCACTCGGCGGCGTC
AAGCAATCCGGCAATGGCCACGACAAATCGCTCCATGCGCTCGATAAATATATCGACC
TGAAAACAGCGTGGATTCAGCTCTGAcgctgtttcctttcatatgagcgacaaaggcggcttcggatttatccagccgcct
ttttcatcatcaatccttgtacatcaaaatatttaacgtgtgaaatatattgacacgttaccgctgtcgcggcaatctaacaaacaaataacgggttcaa
ataATG

    BMEII0123 Gene: BMEII0123     GI: 17988467     BI number: BMEII0123     GOG: COG1574     Description: EXOENZYMES REGULATORY PROTEIN AEPA PRECURSO            at           c  a           t  t            tg            ta            cg           |  c            cg            ta CA       |  c T  G      |  a T  C      |  a       tt AT       |  a      t  a GC        tg        at GT        tg        gc |  G       gc        gc TA        tg       c  | Gc        cg       t  | Cg        gc        ta Gc       c  t       cg At        At        gc Cg        Gc        gc At        Tg        cg At        Cg        gc At        Ta        gc                         tttttcatcatcaatccttgtacatcaaaatatttaacgtgtgaaatatattgacacgttaccgctgtcgcggcaatctaacaaacaaataacgggttcaaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1574 Predicted metal-dependent hydrolase with the TIM-barrel fold ... can be seen here     ..................................................................................................................