                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=53 nt.     Delta G= -9.40 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGGATTGCTCATGATATTTGTTCCCCTGGATACTTGAAAAACCGCGCTCCACATcgcg
gatacaaagttgaaagcgccattccggctgtttttgtattgtttaagcccggatttgatcggttcattatttaaaccgatgcttcaaatatagacttgca
aagagtccgggttcctgtcaagttattcgcatgttaagtatctatgccgtgcgaagcgccctttgagagagtggggagaagcttgcgaaacgccgccgca
aggcgcgttggcaggcatggggcttgacctgaggaggacgaTTG

    BMEII0127 --- BMEII0128 --- BMEII0129 --- BMEII0130 --- BMEII0131 Gene: BMEII0127     GI: 17988471     BI number: BMEII0127     GOG: COG1414     Description: ACETATE OPERON REPRESSOR Gene: BMEII0128     GI: 17988472     BI number: BMEII0128     GOG: COG5441     Description: TRANSCRIPTIONAL REGULATOR Gene: BMEII0129     GI: 17988473     BI number: BMEII0129     GOG: COG1011     Description: HYDROLASE FAMILY PROTEIN Gene: BMEII0130     GI: 17988474     BI number: BMEII0130     GOG: COG0161     Description: OMEGA-AMINO ACID-PYRUVATE AMINOTRANSFERASE Gene: BMEII0131     GI: 17988475     BI number: BMEII0131     GOG: COG0160     Description: 4-AMINOBUTYRATE AMINOTRANSFERAS            CA           C  C           T  A           C  T            Gc            Cg            Gc            Cg            Cg           A  a           A  t           A  a TG       A  c T  A      A  a C  A      G  | A  A       Ta T  A       Ta A  A       Cg         t GC        At       t  c GC       |  t      a  c TG       |  g       cg GC       |  a       cg TG       |  a       gc T  C      |  a      |  t a  |      |  g       cg g  |      T  c       gt c  |      A  g       at aT        Gc        at gC        Gc        at gC        Ta        gt                         gtattgtttaagcccggatttgatcggttcattatttaaaccgatgcttcaaatatagacttgcaaagagtccgggttcctgtcaagttattcgcatgttaagtatctatgccgtgcgaagcgccctttgagagagtggggagaagcttgcgaaacgccgccgcaaggcgcgttggcaggcatggggcttgacctgaggaggacgaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1414 Transcriptional regulator ... can be seen here [S] COG5441 Uncharacterized conserved protein ... can be seen here [R] COG1011 Predicted hydrolase (HAD superfamily) ... can be seen here [H] COG0161 Adenosylmethionine-8-amino-7-oxononanoate aminotransferase ... can be seen here [E] COG0160 4-aminobutyrate aminotransferase and related aminotransferases ... can be seen here     ..................................................................................................................