Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTGTCTGGTGGAAGCGCGCCATGGCGACACGATCAACGCGGATTTCGGGCCTTACGG
CACCATTGCGTGTCATTTTCTGTAGagtggttccggttaaaacggaatcgctggaaccgctctaagtgattgttttgtcgca
ttatcctacgcaaaacggcttcgcacttttgctggaaatggtctggagcgccgtgcgtccatttggacgcacaaaaatcactctaactttctgaacttac
gcatcgtgctttccaaaaatcgatttcgatttttgggctggtgctgaaaggacatttctgATG

    BMEII0139


Gene: BMEII0139     GI: 17988483     BI number: BMEII0139     GOG: COG3836     Description: phosphotyrosyl phosphatase activator (PTPA



  a
t  a
t  a
g  a
 gc
 cg
 cg
 ta
 ta         c
 gt       c  g
 gc       a  c
 tg        at
 gc        gc
 at        gt
G  |      |  a
A  |       ta
T  |       cg
G  |       gt
 Tg        cg
 Cg        ta
 Ta        at
 Ta        at
            gttttgtcgcattatcctacgcaaaacggcttcgcacttttgctggaaatggtctggagcgccgtgcgtccatttggacgcacaaaaatcactctaactttctgaacttacgcatcgtgctttccaaaaatcgatttcgatttttgggctggtgctgaaaggacatttctgATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG3836 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase ... can be seen here

    ..................................................................................................................