                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-31.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-18.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCTGTCGGCTCTCCAGGTTCAGCAGCAGCTTGGCGTTCAGGCTCTGTCGATCGCCAA
CTCGTCGAACCAGTCGATCCTGTCGCTGTTCCGCGGCTAAtaaaccggaccgtttcaggcaaacaggggg
ggggagtatccagcccggccagatcggtttggatacttcaggcggggaggacgggcgcggaatgaattccgcgcccgttcttctttttgcccgacatcct
gtctggcaagccgcaccgcatcctcatcgccactttcgcgcaagcttcgcgcattagcttgcgttcaacaggATG

    BMEII0151 --- BMEII0152 --- BMEII0153 --- BMEII0154 Gene: BMEII0151     GI: 17988495     BI number: BMEII0151     GOG: COG1766     Description: FLAGELLAR M-RING PROTEIN FLIF Gene: BMEII0152     GI: 17988496     BI number: BMEII0152     GOG: COG1766     Description: FLAGELLAR M-RING PROTEIN FLIF Gene: BMEII0153     GI: 17988497     BI number: BMEII0153     GOG: NOG09792     Description: hypothetical protein Gene: BMEII0154     GI: 17988498     BI number: BMEII0154     GOG: COG1360     Description: CHEMOTAXIS MOTB PROTEI            gc           g  g           a  g            cg            tg   a        ta        ga c  g       cg       t  a c  a      a  g       at gt       t  a       at gc       a  |       gc cg       g  |       gc cg        gc        cg c  t       tg        gc gt        tg        cg at        tg        gc cg        gc        gc cg       |  g       gc ta        gc        cg at        cg        at ta        tg        gt gc       a  a       gc at       g  a       at gt        at        gt gc        cg        gc                         tttttgcccgacatcctgtctggcaagccgcaccgcatcctcatcgccactttcgcgcaagcttcgcgcattagcttgcgttcaacaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NU] COG1766 Flagellar biosynthesis/type III secretory pathway lipoprotein ... can be seen here [NU] COG1766 Flagellar biosynthesis/type III secretory pathway lipoprotein ... can be seen here [N] COG1360 Flagellar motor protein ... can be seen here     ..................................................................................................................