Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:201 nt.     Distance to run of Ts=1 nt.   Size=22 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCAACTCGGCAACAATAACAGCACCGACCGTGCGCACGGCTGAtggcgtgttccagacttcatgt
tcaagattggcaggcactctgccgtcatttgttagttttaggcatctccgtttgtgacctccctcatgaaacgccggatatgctccatgatcaaggacca
gaaaatgactgaaacaagcttcgagaacagcctgccgccagaagatttactgattgttgctgcgagctgtgagccggaacaggaacatatgcgggaacca
gacttggtcagggatgcggcgttgaaacccgtcATG

    BMEII0171 --- BMEII0172


Gene: BMEII0171     GI: 17988515     BI number: BMEII0171     GOG: NOG09790     Description: Hypothetical Cytosolic Protein
Gene: BMEII0172     GI: 17988516     BI number: BMEII0172     GOG: NOG08171     Description: hypothetical protei


           ag
          c  a
          c  c
          t  t
          t  t
           gc
           ta
           gt
           cg
           gt
           gt
          |  c
          |  a
          |  a
          |  g        a
           ta       c  c
 GA        At       g  t
T  t      G  t       gc
C  g      T  g       at
G  g       Cg        cg
 Gc        Gc        gc
 Cg       G  a       gc
 At       C  g      t  |
 Cg       A  |       tg
 Gt        Cg        at
 Gt        Gc        gc
                        atttgttagttttaggcatctccgtttgtgacctccctcatgaaacgccggatatgctccatgatcaaggaccagaaaatgactgaaacaagcttcgagaacagcctgccgccagaagatttactgattgttgctgcgagctgtgagccggaacaggaacatatgcgggaaccagacttggtcagggatgcggcgttgaaacccgtcATG


    ..................................................................................................................