Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:161 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G= -9.34 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggcgctggttaatcgccaactagcaggtgcggcgcgcaatatagccagaatacgcatatgttcaacagctatttgcaagtttctgaatctaattcacatt
gcctgtgaaaataacatcaaataggcaataatttcttttaattacaaccacttaatttaatcgcgcaatcgtgcatcatcgcggctttgaggcgaatggc
ctccctgtgctatgtttaagcgatattaaaaatacaaattgccgggaggccgaatgggaattcggcgccgaagcagaacaggaagtcgaggcggagaatc
GTG

    BMEII0229 --- BMEII0230


Gene: BMEII0229     GI: 17988573     BI number: BMEII0229     GOG: -------     Description: hypothetical protein
Gene: BMEII0230     GI: 17988574     BI number: BMEII0230     GOG: COG0225     Description: PEPTIDE METHIONINE SULFOXIDE REDUCTAS



           aa
          t  c
          a  a
          a  t
          a  c
          a  a
          g  a
  g        ta
t  c       gt
t  c       ta
 at        cg
 cg        cg
 at        gc
 cg        ta
 ta        ta
 ta        at
            aatttcttttaattacaaccacttaatttaatcgcgcaatcgtgcatcatcgcggctttgaggcgaatggcctccctgtgctatgtttaagcgatattaaaaatacaaattgccgggaggccgaatgggaattcggcgccgaagcagaacaggaagtcgaggcggagaatcGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG0225 Peptide methionine sulfoxide reductase ... can be seen here

    ..................................................................................................................