Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -8.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCATCTTCACCTTCATGCTGGCTTCGTTCCCGGCTGGTCTGGTGATCTACTGGGCA
TGGAACAACACGCTCTCGATCATCCAGCAGAGTGTCATCATGAAACGTCAGGGCGTGA
AGATCGAACTCTTCGACAACCTCAAGGGGCTTTTCAGGCGAAAACCGAAAGAGGCGAA
TAAATAActccagaaaaaccccgctttggcggggttttttgtgccaacatgggcagggcggttgacaatggagcccattgcattgatgcgtgtac
tcaacagaatacactgaccgggatagaaccaTTG

    BMEII0274


Gene: BMEII0274     GI: 17988618     BI number: BMEII0274     GOG: COG0218     Description: GTP-BINDING PROTEIN CGP


           TA
          A  A
          A  A
          G  T
          C  A
          G  A
 GG        Gc
A  C       At
 CG        Gc
 TA       |  c
 TA       A  a
 TA       A  g
 TA       A  a
C  |      G  a
 GC       C  a       tt
 GC       C  a      t  g
G  G      A  a       cg
G  A      A  c       gc
A  A      A  c       cg
A  A      A  c       cg
 CG        Gc        cg
 TA        Cg        cg
 CG        Gc        at
 CG        Gt        at
                        ttttgtgccaacatgggcagggcggttgacaatggagcccattgcattgatgcgtgtactcaacagaatacactgaccgggatagaaccaTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0218 Predicted GTPase ... can be seen here

    ..................................................................................................................