                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:202 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-18.90 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aacgtccgctttccttcagccgtttcaccatctcggcttcgtcgatggctggcgctttggctgttttcccgcgggcagggcgctgttcctcccgtttttc
cccatcctcggagggaggggcaaaaaggtcgaactgatggcgcatgtaacatctccgcaaggggcaacaggatttggcaaagaatgccattttgcggtgc
tgtaaccaaggccgcaatcgtataagtaacaggtaatcatcctgtcgggcggccgcaaggcagggcgcttgcgtcgggaaaggcatgaggaggggacttc
GTG

    BMEII0291 Gene: BMEII0291     GI: 17988636     BI number: BMEII0291     GOG: COG0579     Description: AMINOBUTYRALDEHYDE DEHYDROGENAS   t t  c cg gt gc cg ta |  t cg        tc tg       t  c |  c      t  c at        tg cg        gc cg        tg        ct a  c       cg       g  g c  g      g  g      c  t t  c       gc        gt t  t       ta        gc t  t       tg        gc gt        tg        at cg        cg       c  | cg        gc        gc gc        cg        gc at        gc        gc cg        gt        cg                         tttttccccatcctcggagggaggggcaaaaaggtcgaactgatggcgcatgtaacatctccgcaaggggcaacaggatttggcaaagaatgccattttgcggtgctgtaaccaaggccgcaatcgtataagtaacaggtaatcatcctgtcgggcggccgcaaggcagggcgcttgcgtcgggaaaggcatgaggaggggacttcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0579 Predicted dehydrogenase ... can be seen here     ..................................................................................................................