                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:29 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-21.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.10 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-14.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGCGCTGGGTGATTACGATAACGCTTTCGACGATTTCAACACGGCGATCACGCTCGA
CCAGAATGTGGCCGAAAGCTGGGCCAATCAGGCGCTGGTCTACGAACACAATGGCGAC
AAGGCAAAGGCTGCAAATTCTTACGCCCGCGCCGTGCAGCTCGACCCGAAGTATAAGC
CTGCGAAAGACGGTCTGGCCCGCACGCGGGGTTAAgtttgcgcatctgcgatacgatcaaagcggcgattcccg
aaccgggggagcgccgcttttctttatcgcaaaccgcgatatattcaatttcATG

    BMEII0335 Gene: BMEII0335     GI: 17988680     BI number: BMEII0335     GOG: COG0346     Description: hypothetical protei TG C  G T  C       tc GC       a  t GC        cg CG        gc A  C       cg G  A      |  a A  |      |  t A  |      |  a A  |      |  c GC       |  g CG       |  a       ac GC       |  t      a  c TG       |  c      g  g CG       g  a       cg CG        ta        cg G  G       ta        cg AT        tg        tg AT        gc        ta TA       |  g      a  g A  A      A  g       gc T  g      A  c       cg Gt        Tg        gc At        Ta        gc At        Gt        cg |  g       Gt        gc Gc        Gc        at Cg        Gc        at                         ttctttatcgcaaaccgcgatatattcaatttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0346 Lactoylglutathione lyase and related lyases ... can be seen here     ..................................................................................................................