Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:7 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.00 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -9.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTTTGCCGCTTTATCTGATCGAACAGGAATTGCGGAGTGGCGAACTGGTGCTGCTTT
TTGAAAAACCAATGCGAACCGAGAATGAATATTATCTCGTTGTGCCGGAGGGAAAACT
GGAAAATCCGCTGACGCAGGTGTTCTGCCAGTGGATCGCCGGGCAGGTCGGGAATACC
GACTACTCGTCGTTGGTTCATTCCAAACCGGAATGAattgttgcgcaaataacgctgtccaaccggctttcgc
ggcgtgaaatagaagcagtcgggcagggtgcccgtgtttcactattttaatggTTG

    BMEII0391


Gene: BMEII0391     GI: 17988736     BI number: BMEII0391     GOG: COG0665     Description: SARCOSINE OXIDASE BETA SUBUNI


            g
          g  c
           cg         g
           gt       g  g
 ca        cg       a  t
c  a       ta        cg
t  c      |  a       gc
 gc       |  a       gc
 tg       |  t       gc
 cg       |  a       cg
 gc       |  g      t  |
c  |       ta       g  |
a  |       ta       a  |
a  |       cg       c  |
t  |       gc       g  |
 at       g  a      a  |
 at       c  |      a  |
 at        cg       g  |
c  |       at        at
 gc       a  c       tg
 cg        cg        at
 gc        cg        at
 tg        tg        at
 tg        gc        gc
 gc        ta        ta
 tg        cg        gc
                        tattttaatggTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here

    ..................................................................................................................