                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-22.50 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-24.16 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTCTGGTTGCCGAAGCTGACCGCCTGGAAGCTGCCATTGCTGGCGTTCTGGACGAC
GGTATCCGCACCGCCGATATCTGGTCGGAAGGCAATACCAAGGTCGGCACCACCGAAA
TGGGCGATGCCATCCTTGCAAAGTTCAAGGCACTTTCGGCCTGAtcgaagcagaagcccggagcggt
tcccgctttgggggaaacggaaagcctgtcatgcaagctgcatggcgggcttttcttttcgcaataagcgcccgattttaggctgcaacatccgggtcag
agtttaagaatggcggcATG

    BMEII0405 Gene: BMEII0405     GI: 17988750     BI number: BMEII0405     GOG: COG0350,COG2169     Description: ADA REGULATORY PROTEIN / O-6-METHYLGUANINE-DNA-ALKYLTRANSFERAS             t           t  c            gc            gc            cg            gc            at            gt            gt            cg            cg            cg           g  |           a  |           a  |   T       g  | C  G      a  | C  A      c  | Gt       g  | Gc       a  | Cg       a  | Ta       g  | Ta       c  | Tg       t  | |  c      A  | |  a      G  | |  g      T  |        g C  a       Cg       a  c A  a       Cg       a  t Cg       |  a       cg Gc       |  a       gc Gc       G  a       ta A  c       Gc        at A  g       Cg        cg Cg        Tg        tg Ta        Ta        gc Tg        Ta        tg Gc       C  a       cg A  g      A  |       cg A  |       Cg        gc A  |       Gc        at Cg        Gc        at Gt        At        at                         tcttttcgcaataagcgcccgattttaggctgcaacatccgggtcagagtttaagaatggcggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0350 Methylated DNA-protein cysteine methyltransferase ... can be seen here [F] COG2169 Adenosine deaminase ... can be seen here     ..................................................................................................................