                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -3.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCCTCGTGATCTATTTCAGCGTTGCGCTGGTCATTCTGTCGGGCACGCTTTTATAA
ggcccgggcatgtcacgaagcagtggaaaccggttttttgatcacgacatgcccagaaaaattcaaaaaactgacagattaggcgtgtaaaagccgattg
aaattcaggttttatggcctaaataataggcagtttcgcgctgcctctttctaaaacgcaaaaaaacctgtaagagcgccgcattgtttttccgcgcggg
tttattggcgcggctcccaactcatatagaagtgatctccatATG

    BMEII0419 Gene: BMEII0419     GI: 17988764     BI number: BMEII0419     GOG: COG1217     Description: GTP-BINDING PROTEIN TYPA/BIP            TA           T  T            TA            TA            Cg           G  |           C  |           A  |            Cg            Gc        ag            Gc       a  c            Gc       g  a            Cg        cg           T  |       at CT       G  |       cg T  G       Tg        tg T  T       Cg       g  a A  C      T  c      t  a CG        Ta       a  a TG        At       c  | G  G       Cg       g  | GC       T  |       gc TA        Gt        gc GC        Gc        cg TG        Ta        cg                         ttttttgatcacgacatgcccagaaaaattcaaaaaactgacagattaggcgtgtaaaagccgattgaaattcaggttttatggcctaaataataggcagtttcgcgctgcctctttctaaaacgcaaaaaaacctgtaagagcgccgcattgtttttccgcgcgggtttattggcgcggctcccaactcatatagaagtgatctccatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG1217 Predicted membrane GTPase involved in stress response ... can be seen here     ..................................................................................................................