                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.01 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGATGAAGCCGTGAAGCTTACCCCGCCGATCAAGATGACGCTGGAACGCGCCCTGTC
GTGGATTCAGGATGACGAACTGGTGGAAGTGACGCCGAAGTCGATCCGTCTTCGCAAG
CTTTATCTCGATCCCAATGAGCGCAAGCGTTTTGAGAAGAGCAAGTCGTCGAGTGCTG
CATAAcaagcccgacagcatataagaaaacggcgctttcgggcgccgtttttgtttgaatattcattgtgcactgatcgcacatggggcattcatca
cgacagcctgccaatgtccggtgtgtgcaATG

    BMEII0420 Gene: BMEII0420     GI: 17988765     BI number: BMEII0420     GOG: COG1739     Description: THYMIDYLATE SYNTHAS   A        ga A  G      c  c G  A      c  a A  G       cg GC        gc TA       |  a TA       |  t TG       |  a T  T      a  t GC       a  a CG       c  a GT       A  g |  C      A  a       tc A  G      T  a      t  g A  A      A  a       tg CG       C  a       cg GT        Gc        gc CG        Tg        cg GC        Cg        gc AT        Gc        gc |  G       Tg        cg GC        Gc        at TA        At        at AT        Gt        at                         ttgtttgaatattcattgtgcactgatcgcacatggggcattcatcacgacagcctgccaatgtccggtgtgtgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1739 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................