                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:147 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G=-15.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-21.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAAGACGACCTGTCGCGCCTTGTGAGCGACCTTACGCGCGGCAAGACGATTATCACG
TTCGACGAATAGagacatgctttaaagtttaacgatcatccgctgcctgatcctgccttccggggaaaggtgaggcccggcggaagccggg
tcttttggtttcaagggggtgagtcgcggccctgtggcgccttttttccggccttggccctgtaaaacaggggtctcaaaaaaataatcgcacttaagat
cacatttaaatcgttataatgttatggccgtattgttatgcttctgaaaggGTG

    BMEII0421 --- BMEII0422 --- BMEII0423 Gene: BMEII0421     GI: 17988766     BI number: BMEII0421     GOG: -------     Description: hypothetical protein Gene: BMEII0422     GI: 17988767     BI number: BMEII0422     GOG: COG0158     Description: FRUCTOSE-1,6-BISPHOSPHATASE Gene: BMEII0423     GI: 17988768     BI number: BMEII0423     GOG: COG0191     Description: FRUCTOSE-BISPHOSPHATE ALDOLAS cc t  g tg cg cg g  a t  a c  a cg tg at g  g ta cg cg gc |  c       ga |  c      g  a tg        cg cg        gc gc        gc cg        cg cg        cg ta        cg             tcttttggtttcaagggggtgagtcgcggccctgtggcgccttttttccggccttggccctgtaaaacaggggtctcaaaaaaataatcgcacttaagatcacatttaaatcgttataatgttatggccgtattgttatgcttctgaaaggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0158 Fructose-1,6-bisphosphatase ... can be seen here [G] COG0191 Fructose/tagatose bisphosphate aldolase ... can be seen here     ..................................................................................................................