                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:10 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATTCATTCACGAATCTGGCTGGACCGGCCGGAAATTATCCGTTGGTTCCAGATCATC
GGTTATCACGAAAACGGAAATGAAAACGGCGCGAAGCTTTACGAGCTGCCACCGACGT
CAGATGCCAGAGCCTGAcagaacggatccatgtttccgtaattaatgaaaatctatatacgaatcggggcgtaaggcatccgccaaaa
gcgggcgtatgatggcgacatcaatagtggggggacattttgaacagcttcattctttctggcaggctcggctatgccgaaatttttaaatcacctGTG

    BMEII0442 Gene: BMEII0442     GI: 17988787     BI number: BMEII0442     GOG: -------     Description: Hypothetical Membrane Spanning Protei cg g  a gc ta at gc ta a  a t  t       ag g  a      c  c c  |       at g  |       at         c g  |       gc       t  g g  |       ta        cg cg       t  t       gc gt       t  |       gt a  g      t  |      |  a a  |      a  |       at a  |      c  |       cg a  |       at        gc cg        gc        gc cg        gt       t  | g  g      g  t       cg cg       g  t       ta cg        gc        ta ta        gt        ta                         tttttaaatcacctGTG     ..................................................................................................................