Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:188 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.79 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -7.96 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcgtgattgcaatgccgtaataattcgttctgccaacattcttacaaacgtggtaaagaaccggttaatattggctgacaggcgcgttttttagggctt
gccagccgttttctgtctataatggtgaggatgatttcatatccctgcaatgccggtgattatcggttctgaagattggtatatgaaatgaatgctgggc
agcgcggtgggcgtttccgggggcggaaacaggatcgagtatgcgcgggcagacaaatgcaccgaggatgacaattgccgattttctggtcggtgatgga
ATG

    BMEII0467


Gene: BMEII0467     GI: 17988812     BI number: BMEII0467     GOG: COG0789     Description: TRANSCRIPTIONAL REGULATOR, MERR FAMIL


  t
t  a
c  c
t  a
t  a
a  a
c  c
a  g
 at
 cg
 cg
 gt
|  a       aa
|  a      t  t
 ta        ta        tt
 cg        gt       t  t
 ta        gt       t  t
 ta        cg       g  a
 gc        cg       c  g
c  |      a  c      g  g
t  |      a  t       cg
t  |      g  g       gc
a  |      a  a       gt
a  |      a  c       at
t  |      a  a       cg
a  |      t  g      a  c
a  |      g  g       gc
t  |       gc        ta
 gc        tg        cg
 cg        gc        gc
 cg        cg        gc
 gt        at        tg
                        ttttctgtctataatggtgaggatgatttcatatccctgcaatgccggtgattatcggttctgaagattggtatatgaaatgaatgctgggcagcgcggtgggcgtttccgggggcggaaacaggatcgagtatgcgcgggcagacaaatgcaccgaggatgacaattgccgattttctggtcggtgatggaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0789 Predicted transcriptional regulators ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:206 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -5.06 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcgtgattgcaatgccgtaataattcgttctgccaacattcttacaaacgtggtaaagaaccggttaatattggctgacaggcgcgttttttagggctt
gccagccgttttctgtctataatggtgaggatgatttcatatccctgcaatgccggtgattatcggttctgaagattggtatatgaaatgaatgctgggc
agcgcggtgggcgtttccgggggcggaaacaggatcgagtatgcgcgggcagacaaatgcaccgaggatgacaattgccgattttctggtcggtgatgga
ATG

    BMEII0467


Gene: BMEII0467     GI: 17988812     BI number: BMEII0467     GOG: COG0789     Description: TRANSCRIPTIONAL REGULATOR, MERR FAMIL


            t
          t  a       tt
          c  c      g  a
          t  a      g  a
          t  a      c  t
 aA       a  a      c  a
g  T      c  c      a  t
g  G      a  g       at
 tg        at        gg
 at        cg        ag
 gt        cg        ac
t  |       gt        at
 gc       |  a      t  g
 gt       |  a       ga
 cg        ta        gc
t  |       cg        ta
 gc        ta        gg
 gc        ta        cg
 ta        gc        ac
                        gcgttttttagggcttgccagccgttttctgtctataatggtgaggatgatttcatatccctgcaatgccggtgattatcggttctgaagattggtatatgaaatgaatgctgggcagcgcggtgggcgtttccgggggcggaaacaggatcgagtatgcgcgggcagacaaatgcaccgaggatgacaattgccgattttctggtcggtgatggaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0789 Predicted transcriptional regulators ... can be seen here

    ..................................................................................................................