                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:62 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-13.46 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACGCCGTGCTGGACGAGACAGCCATAGCCATGCCAAGGCGTAAGGAACAAaccaaggcgac
gtttacaacagccacaagcaaatcggtcgcacgaacttgtgaatttttgacgtttacggaaacgtcaaagtacgctagttttggccggaattggattgat
cactatacgggcggggggaagtgatcggccaaaaggcagcaaaaatggctgattttcgggtgaaaagggcctttttctgcaacaagcatgttgccatggc
gattccgcccttatgtgaccaatcatgcatgaacgtggTTG

    BMEII0495 --- BMEII0496 --- BMEII0497 Gene: BMEII0495     GI: 17988840     BI number: BMEII0495     GOG: COG1960     Description: ACYL-COA DEHYDROGENASE Gene: BMEII0496     GI: 17988841     BI number: BMEII0496     GOG: COG0183     Description: 3-KETOACYL-COA THIOLASE Gene: BMEII0497     GI: 17988842     BI number: BMEII0497     GOG: COG1024,COG1250     Description: ENOYL-COA HYDRATASE / 3-HYDROXYACYL-COA DEHYDROGENASE / 3-HYDROXYBUTYRYL-COA EPIMERAS   c g  g g  g g  g c  g a  g t  g a  a ta cg at cg ta at gc tg         a        gg tg       a  a      g  t a  |      a  t       cg gc       a  g       ta gc        cg        ta ta        gc        ta ta        at        ta a  a       cg       a  g a  a      |  a      g  | g  |       gt        tg g  |       gt        cg cg        at        gc cg        at        gc                         tttttctgcaacaagcatgttgccatggcgattccgcccttatgtgaccaatcatgcatgaacgtggTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here [I] COG0183 Acetyl-CoA acetyltransferase ... can be seen here [I] COG1024 Enoyl-CoA hydratase/carnithine racemase ... can be seen here [I] COG1250 3-hydroxyacyl-CoA dehydrogenase ... can be seen here     ..................................................................................................................