                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGCACCGGCAGACACCCAGAACCATTGAGCTTCATTCGCTCAATCCCGAGCATCCCA
ATCGCATCTTTGAATCCAAGGATATCGAATGGATCGCCCGTATTCTCTGGGCGAGCCA
GTAAatgatgcagcgacgcgaaaaaagccatgcgcatttcgtcttcggcagtttggcctgtcttaccggggccgttctgatagccgcttttgtcgcc
cctttttatggtgcgctggatcgtcgggtcgtggtgatcgattccggtagcgcggaaaagagcgataagggtgcgaagaacggcatcGTG

    BMEII0499 Gene: BMEII0499     GI: 17988844     BI number: BMEII0499     GOG: COG1525     Description: SUCCINOGLYCAN BIOSYNTHESIS PROTEIN EXO   t t  a c  c t  c g  g       gc tg       c  t cg       c  t cg        gt gc        at gc        tg tg        at t  t       gc t  t      t  | gc       c  | at       t  | |  g      t  | |  a      g  | |  t      c  | |  a       cg cg        gc gc        gc gc        gc cg        gc             tttttatggtgcgctggatcgtcgggtcgtggtgatcgattccggtagcgcggaaaagagcgataagggtgcgaagaacggcatcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1525 Micrococcal nuclease (thermonuclease) homologs ... can be seen here     ..................................................................................................................