                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -7.30 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -8.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTTTCGGTTTTCACCGTGGAAACCACATCCTCGGCGAGCTTCTTGCCATCGATCAA
TTGGGCCATCGTGATCGCTCCGTTTTCAGCAGATGATGCAGCATCCTGCATCACGTCG
TTTGCGCACATatgcccataagcgtcatggggccgtatgacaatcgttcaaagcgcgacaattgcgctattttttaagtttgcccccgtttg
ggcactacctgcggctgcaacaattttacaaccggtgggcgttgaaacgcgttgccatagacaaaaaggcactgctccatccataaaaagtcATG

    BMEII0509 Gene: BMEII0509     GI: 17988854     BI number: BMEII0509     GOG: COG0345     Description: PYRROLINE-5-CARBOXYLATE REDUCTAS            ga   c       t  c g  g      a  a a  t       ta a  c       gt ta       c  c at        cg cg        gt cg        gt cg        gc         a |  g      g  a      c  a |  c      t  a       at gc       a  a       gt tg       c  |       cg at        tg        gc Ta        gc        cg At        cg        gc Cg        gc        at                         attttttaagtttgcccccgtttgggcactacctgcggctgcaacaattttacaaccggtgggcgttgaaacgcgttgccatagacaaaaaggcactgctccatccataaaaagtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0345 Pyrroline-5-carboxylate reductase ... can be seen here     ..................................................................................................................