                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-18.60 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-16.50 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTCGCTATTGCCCGCCTGCGCATGGAGGCGGCGCGCCACATTTGTTGAttattgaaaatctgg
caggcgccaccttcacatgccgggccccctcccggccagcctgccctttgcccggccaatccttcactggccgggctttttttatcgtatccaaaggaaa
aaacataaagctccgccagtcccatttacgcggccccaacaaaaatgatccctgcccgcagaaacgcaaagggccatttgtcaagagcgcctgtcacagc
tatcatatcaatatcgaaatgattttctggtgatggATG

    BMEII0523 --- BMEII0522 --- BMEII0521 Gene: BMEII0523     GI: 17988868     BI number: BMEII0523     GOG: COG0174     Description: GLUTAMINE SYNTHETASE Gene: BMEII0522     GI: 17988867     BI number: BMEII0522     GOG: NOG07297     Description: hypothetical protein Gene: BMEII0521     GI: 17988866     BI number: BMEII0521     GOG: COG0665     Description: OXIDOREDUCTAS            gc           a  c           c  t            cg            gc            gc           c  c           c  t        t           c  t      c  t           t  t      c  c           c  |      t  a           c  |      a  c cc       c  |       at c  c      c  |       cg c  t       cg        cg gc        gc        gc gc        gc        gc gc        gc        cg cg        cg        cg cg        cg        cg gc        gc        gc                         tttttttatcgtatccaaaggaaaaaacataaagctccgccagtcccatttacgcggccccaacaaaaatgatccctgcccgcagaaacgcaaagggccatttgtcaagagcgcctgtcacagctatcatatcaatatcgaaatgattttctggtgatggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0174 Glutamine synthetase ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here     ..................................................................................................................