                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -5.52 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatcgggctggcgggttgtttcctgctttcaaccgttttgtacggccccaaaatttgctgcgtaacctttcaaaaaataatccaaggggacggggagcag
cgtggtgaacctggatgaattctcggctgtgggtggacatgtcgcgaaatgacctatatagaatcaggcaacctttcaataatcattctgtgcggacctc
ctgcggtaagcaaattgtgcatgggcgttttgcacgggaatgaagtcttatcaatgtaaaaaaggagcttaagtccgccagcacagcggggttaaattta
TTG

    BMEII0548 Gene: BMEII0548     GI: 17988893     BI number: BMEII0548     GOG: COG4175     Description: GLYCINE BETAINE/L-PROLINE TRANSPORT ATP-BINDING PROTEIN PRO tg a  g cg gc tg g  t t  | t  | at at at         g cg       t  t gc       a  a a  a      a  a a  |      c  a t  |      t  a g  |      a  a g  |       ta c  |       tg gc        cg         c tg        ta       g  a cg       |  g      a  c cg        gc       c  a ta        at        cg |  a       at        gc |  t      g  a       cg |  g      t  a       cg |  a      a  g       tg c  a      a  |      g  g cg        gt        at at        gc        at gc        gc        ta gt        cg        ta                         atttaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG4175 ABC-type proline/glycine betaine transport system, ATPase component ... can be seen here     ..................................................................................................................