                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:89 nt.    Distance to gene:75 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-30.30 kcal/mol
Antiterminator:    Distance from promoter:62 nt. Size=35 nt.     Delta G=-13.30 kcal/mol
Anti-antiterminator:    Distance from promoter:60 nt.    Size=20 nt.     Delta G= -5.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAC-TAAAGT. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAACTTACAAAAAACGACGCGCTAAAGTTGCTCAATGCAGCATTGGAAGGTAGATA
Aatcgctggccagacggtaatcaggtcaggcgtcgcgccaccatgggtgggggcggcgcatgagggggcaggttcttggggaggagcctgccccctttca
ttctttccttcttcgcgccaatgcccggaacaaatcgatatttcaagcgtttgacctggagtttgaatagggagagttgaacATG

    BMEII0552 Gene: BMEII0552     GI: 17988897     BI number: BMEII0552     GOG: NOG08130     Description: hypothetical protei             g        gg           g  g      g  g           g  c       ta           g  g       tg            tg        cg            gc        ta           g  g       tg            gc        gc ca        ta        gc c  t       at        at a  g       cg        cg cg       c  a       gc cg       a  g       gc gt        cg        gc cg        cg        gc g  g      g  g       gc cg        cg        at tg        gc        gt                         tcattctttccttcttcgcgccaatgcccggaacaaatcgatatttcaagcgtttgacctggagtttgaatagggagagttgaacATG     ..................................................................................................................