                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-11.60 kcal/mol
Anti-antiterminator:   Size=72 nt.     Delta G=-27.31 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCCGGAAGATCTTGCAGCCAATCAGGATGCTTATTGCCTCAACTGGCTGCTTGAGGA
AGTCTCGACCTCCATCAACACCACGGCAGCAGGCGGCAACGCCAGCCTGATGGCGATC
GGCTGAtttcttcgcatatgtgaggcagaaaaggcggctttccggccaccttttctttgcgccacgcaaggcttgcatggctgtgcagaaaaatcg
acaacagaacgattagattattttctgaaaaatcggaataaaatttacaacgtgattgacagcccgatttaaaaggcgaagactatatATG

    BMEII0565 Gene: BMEII0565     GI: 17988910     BI number: BMEII0565     GOG: COG1840     Description: IRON(III)-BINDING PERIPLASMIC PROTEIN PRECURSO CA G  A GC CG GC GC A  A C  | G  | A  | CG GC GC C  | A  | C  | C  | A  | C  | A  | AT CG TA        ta AT       a  t CG        cg CG        gt T  C       cg C  G       ta C  A       tg AT        cg GC       |  c CG        ta        tc TG        tg       t  c |  C       ta        tg |  T      A  a       cg CG       G  a       gc TA        Ta        gc Gt        Cg       c  a At       G  g       gc At        Gc        gc Gc        Cg        at Gt        Tg        at                         ttctttgcgccacgcaaggcttgcatggctgtgcagaaaaatcgacaacagaacgattagattattttctgaaaaatcggaataaaatttacaacgtgattgacagcccgatttaaaaggcgaagactatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1840 ABC-type Fe3+ transport system, periplasmic component ... can be seen here     ..................................................................................................................