                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -9.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-22.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGCATGGGCGGATCGAAGCACGGACCTATCTTGGTGAAAGTGAAGAACTGGTCGTG
AAGGCGGGCGACATGCCGCTTCGCCTGCATGTGCGCGGTGAAGCGCCTATTCCCTCTG
GTCTGGCCGATGTGTCGCTTTGCCCGCATTGGGAAAAGGCGCTTGTTTTCCCCGATTG
Atgcgcgatcgacgtgaaggagcgagctttcgccgctgccgcaggttgatcttttatggccggcatcctagatacctgatccatatactcatgattcaaa
atctaactggttcatccggaggtaaaATG

    BMEII0584 Gene: BMEII0584     GI: 17988929     BI number: BMEII0584     GOG: COG1840     Description: IRON(III)-BINDING PERIPLASMIC PROTEIN PRECURSO TG A  T CG GC TG |  C CG        GG CG       T  T GT       C  C CG       T  T TA        CG TA        CG CG       |  C GC       C  C C  |       TG CG        TA         A GC        AT       C  T T  C       TG       G  T A  T      |  T       CG C  A      C  G       CG A  T      C  T       CG G  T       GC       |  A C  |       CG       G  A GC        GC        TA GC        AT        TA GC        AT        TG C  T       GT        CG GC        TG        GC GT        GC        CG                         CTTGTTTTCCCCGATTGAtgcgcgatcgacgtgaaggagcgagctttcgccgctgccgcaggttgatcttttatggccggcatcctagatacctgatccatatactcatgattcaaaatctaactggttcatccggaggtaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1840 ABC-type Fe3+ transport system, periplasmic component ... can be seen here     ..................................................................................................................