                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-19.50 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -8.90 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -7.49 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTCCCGTCAAGGTCGTGGCGGAAAAGGACGAAGCCACCGCCTCTGGCATCATCGTG
CGCAAGGGCGACGACGAGCTGGTCGCCGCCATCAACAAGGCGCTCGATGAAATCAAGG
CCGATGGAACCTACAACAAGATCTCGCAAAAATATTTCGGCCAGGACGTTTCCAAGTA
Atattctgcctgcccgcaatcggcgaagccggatcagatccggcttcgttttgttgactgcggcaaatattcccaggacagaattgccagaccgtataac
atgaccgaatgcacttcttgctgtgcATG

    BMEII0600 --- BMEII0599 Gene: BMEII0600     GI: 17988945     BI number: BMEII0600     GOG: COG0765     Description: CYSTINE TRANSPORT SYSTEM PERMEASE PROTEIN Gene: BMEII0599     GI: 17988944     BI number: BMEII0599     GOG: COG1126     Description: CYSTINE TRANSPORT ATP-BINDING PROTEI GT A  A A  A C  t C  a        t T  t      a  c T  t      a  g T  c       cg Gt        gc Cg        cg         a A  |      |  a      c  g Gc       c  a       ta Gc        cg        at At        gc        gc Cg       t  c       gc C  c       cg        cg Gc        cg        cg Gc       |  a       gc Cg       |  t       at T  c       gc        at Ta        ta        gc Ta        cg        cg At        ta        gt                         tttgttgactgcggcaaatattcccaggacagaattgccagaccgtataacatgaccgaatgcacttcttgctgtgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here [E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here     ..................................................................................................................