                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-12.42 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGCCATTCTCGATGCGCTCAAGGTTTGCGGTGCAATCCTCATCGGCATTCTGGTCAT
CACCGTTGCGTCCATCGCGCTCGGCATCAGCCAGTTTGGCGGTATTTTTTCCGCTCCT
CCGAGCCTCGCGCCCACCTTCTTGCAGCTCGATATCATGGGCGCGCTGCATACCGGCA
TCCTCCATGTCATTCTCGTATTCGTGCTGGTTGAGGTTTTCGATGCCACCGGCACACT
GAtcggcgtcgccaagcgcggcggcctgatcgagacgggcaagccgaacaatctgggccgcgccctgtTTG

    BMEII0618 Gene: BMEII0618     GI: 17988963     BI number: BMEII0618     GOG: COG2252     Description: XANTHINE/URACIL PERMEAS   G G  C C  A T  T A  T C  C T  T CG CG T  T A  C A  A C  T GC TA GC                  TC GC                 A  A CG                  CG GT                  GC T  T                 GC T  |        A       C  | T  |      C  T       TA G  |      C  C       CG G  |       TG        GT A  |       GC       |  T A  |       CG       |  T C  |       GC       |  G T  |      T  T       CG CG       T  |       GC GC        GC        CG CG        CG        TG GT        CG        AT                         ATTTTTTCCGCTCCTCCGAGCCTCGCGCCCACCTTCTTGCAGCTCGATATCATGGGCGCGCTGCATACCGGCATCCTCCATGTCATTCTCGTATTCGTGCTGGTTGAGGTTTTCGATGCCACCGGCACACTGAtcggcgtcgccaagcgcggcggcctgatcgagacgggcaagccgaacaatctgggccgcgccctgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2252 Permeases ... can be seen here     ..................................................................................................................