                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-13.60 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-18.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATATTTTCGGCGCGGACGGACGCCGCGTGAGCGACTGAttcatgccaaaacccgatgagcctcactcatc
gggttttggttaagcccatgcgccgatctgattctttcagatcaaaatgcgcttcaggcagacggttgcgctgcaaacaaggacgcaaccgttgtttcct
gttccgcggcaggtacgtgcacagtccgcataggggcttgcatgtgtattgcaataatccatttctgttttagtttttatcggttacacagaggcggaat
tattttccatcctgaggaatctccaatagATG

    BMEII0620 Gene: BMEII0620     GI: 17988965     BI number: BMEII0620     GOG: COG0471     Description: SULFUR DEPRIVATION RESPONSE REGULATO   c t  t t  t at gc ta cg ta at gc |  a |  a |  a |  a c  t cg gc                  aa cg                 a  c gc                 c  a |  t                g  a t  t                 tg a  c                 cg c  a       tt       |  a cg       g  g       gc cg        gc        cg gc        cg        gc a  a      a  |       ta a  |       gc        ta tg        at        gc ta        cg        gc gc        gc        cg                         ttgtttcctgttccgcggcaggtacgtgcacagtccgcataggggcttgcatgtgtattgcaataatccatttctgttttagtttttatcggttacacagaggcggaattattttccatcctgaggaatctccaatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0471 Di- and tricarboxylate transporters ... can be seen here     ..................................................................................................................