                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACATTCTGAATGAAGAGTTTGAAGCCATGCTGGGCGGCAAACAGGACGCGAAGACCG
CACTCGACAACGCCGTCAAGCGCGGCAACGCAGCAATCGCCGCAGCTCAATAAtccatcat
atcgagacaatgccgccaaccctttccggggttggcgacattgctgctcacgaggaagcttcccgtgcagaaagtaacctttccgaataagatcctgcct
tatttcctgctggcaccgcagatcgttttgactgtggttttcttcttctggccggcaagtcaggcaatttattagtccttcATG

    BMEII0624 --- BMEII0623 --- BMEII0622 --- BMEII0621 Gene: BMEII0624     GI: 17988969     BI number: BMEII0624     GOG: COG1175     Description: SN-GLYCEROL-3-PHOSPHATE TRANSPORT SYSTEM PERMEASE PROTEIN UGPA Gene: BMEII0623     GI: 17988968     BI number: BMEII0623     GOG: COG0395     Description: SN-GLYCEROL-3-PHOSPHATE TRANSPORT SYSTEM PERMEASE PROTEIN UGPE Gene: BMEII0622     GI: 17988967     BI number: BMEII0622     GOG: COG0395     Description: SN-GLYCEROL-3-PHOSPHATE TRANSPORT SYSTEM PERMEASE PROTEIN UGPE Gene: BMEII0621     GI: 17988966     BI number: BMEII0621     GOG: COG3839     Description: SN-GLYCEROL-3-PHOSPHATE TRANSPORT ATP-BINDING PROTEIN UGP   c c  t t  g a  c gc at at                   t ta                 t  t at                 g  t at                  cg gt                  ta |  c        c       a  | c  c      g  a       gc c  t      g  c       at t  g      t  c       cg t  c       cg        gt t  t       gc        cg cg        ta        cg cg        cg        at                         tttcttcttctggccggcaagtcaggcaatttattagtccttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here [G] COG3839 ABC-type sugar transport systems, ATPase components ... can be seen here     ..................................................................................................................