                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:64 nt.    Distance to gene:155 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-16.10 kcal/mol
Antiterminator:    Distance from promoter:55 nt. Size=36 nt.     Delta G=-13.90 kcal/mol
Anti-antiterminator:    Distance from promoter:16 nt.    Size=49 nt.     Delta G=-14.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGAAA-CATATT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGAAAGACGATGAGGAATTGCGGCATATTCCCGTCATCGCGGTCACGGCATTTGCCA
TGAAGGGCGATGAGGAGCGCATAAGGCAGGGTGGCTGCGAGGCCTATATCTCGAAGCC
GATCTCGGTGCCTCGCTTTATTGAAACCATAAAGTCCTATCTGGGCGATGCCTAGcgcg
gtttttgttttaacagaatcgccggaacgctctaactatttgttttgtcgcattatccgacgcaaaaccgcttcgcatttttgctggaaatgctctaaaa
ctttcaaggatgcgcaATG

    BMEII0660 Gene: BMEII0660     GI: 17989005     BI number: BMEII0660     GOG: COG3706     Description: RESPONSE REGULATOR PROTEI AG G  G T  A                 TC A  G                A  T GC                  GC CG                  CG GC                  CG G  A                 GT G  |                A  | A  |       TA       A  | A  |      C  T      G  | GT       C  A      C  | TA        GT       T  | A  A       GC       C  | CG        AT       T  | CG        GC       A  | GC        CG       T  | TA       G  A      A  | TG        TA       T  | TG        CG       C  | |  G       GC        CG |  T       GC        GC A  G       TG        GC CG       G  A       AT GC       G  T       GC GT        GC        CG CG        AT        GC                         TTTATTGAAACCATAAAGTCCTATCTGGGCGATGCCTAGcgcggtttttgttttaacagaatcgccggaacgctctaactatttgttttgtcgcattatccgacgcaaaaccgcttcgcatttttgctggaaatgctctaaaactttcaaggatgcgcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG3706 Response regulator containing a CheY-like receiver domain and a GGDEF domain ... can be seen here     ..................................................................................................................