                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:153 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-12.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-13.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATGTTGGCCGGACCGCAACTCGTCGGCATCGGCATGGATGCGATGGGGCCGAAGGGT
TTCCCGATGACGCTCGGCATATTTTTTGCCGCATATGCGCTCTTTGCTGCGGTTAGGT
TGCTTTTGCGGAAGAAGCAGTCTTGActttttgcctctaatccgtagtgtcgcgccgaatttccgctgccggatgaattgc
cggaatcgttggcggtttctatcaatcgtgcatgatcccggaaagtgggaaccggttttcgggaagatcatgcccggcaggcacttagagcaggtatatc
gatATG

    BMEII0661 Gene: BMEII0661     GI: 17989006     BI number: BMEII0661     GOG: COG0267     Description: LSU ribosomal protein L33   T T  T A  T T  T AT CG GC GC CG T  | C  |       GC G  |      T  G C  |       CG A  |       GT         G GC       T  T      C  G TA       T  |      G  A AT        TA        TA G  A       CG        TG C  T      T  G       TA C  G      C  T       TA C  C       GT        CG T  |       CG        GC T  |       GC        TA TG       T  T       TG GC       A  T      |  T GT       T  T       GC GC        AT        GT AT        CG        AT AT        GC        TG GT        CG        TA CG        CG        Gc                         tttttgcctctaatccgtagtgtcgcgccgaatttccgctgccggatgaattgccggaatcgttggcggtttctatcaatcgtgcatgatcccggaaagtgggaaccggttttcgggaagatcatgcccggcaggcacttagagcaggtatatcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0267 Ribosomal protein L33 ... can be seen here     ..................................................................................................................