                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -9.82 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTGCCGGAGGTGGAGACCCAGAAACTTGTTCCAAGCGGCGAACTGGAAGATCTTGAC
TGGGTTTTGATCGACCAGATCGAAAAACTTGATCTCGCCCGTATCACCCAGGCGATCC
TGAACGAAGCCACCGCGCTTTTGATGGATACGCAGCTTGATCTGCCTGCCACCCTGCC
GGTGGTGCAATACAGCAAGCGGCATGACCGCTTTGTTCGCGAAGTGATCTGAaccctatga
ataaagaaatccaacccgccgatcttgtcccgcgagagccagccggtggaccgacagggggccagATG

    BMEII0662 Gene: BMEII0662     GI: 17989007     BI number: BMEII0662     GOG: COG0477     Description: TRANSPORTER, MFS superfamil                       G                     A  C TG                 C  A T  A                A  A C  T                T  G GC                 A  C AT                 A  G CG         G        CG GC       T  C       GC C  C      C  C       TA AT        CG        GT TG        CG       G  G A  |       AT        TA GC        CG        GC GC        CG        GC TA        GT        CG                         CTTTGTTCGCGAAGTGATCTGAaccctatgaataaagaaatccaacccgccgatcttgtcccgcgagagccagccggtggaccgacagggggccagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GEPR] COG0477 Permeases of the major facilitator superfamily ... can be seen here     ..................................................................................................................