                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-15.00 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cgacgcgcccgacaTTGTTCAATTATATTGCCAGGCGGGCCGATCTGGAAAAGACGACTGCTGA
GCTTTTCGATGTCGTGGAAAGCGGGGCGGTCAAGATCGAGATCAACCAGACCTATGCT
CTCAAGGACGCCTGCAAGGCCCATGAAGCATTGGAGGCACGCAAGACGACAGGCACGA
GCATCCTGTTGCCATAGgtggggacgatagcggcggtgcatatgtccatcgctgctttcttttgggcttttcaagagcgggcttgctg
gataaagtcgctcaaaaatactttggggaacaATG

    BMEII0698 --- BMEII0699 --- BMEII0700 --- BMEII0701 Gene: BMEII0698     GI: 17989043     BI number: BMEII0698     GOG: COG3845     Description: SUGAR TRANSPORT ATP-BINDING PROTEIN Gene: BMEII0699     GI: 17989044     BI number: BMEII0699     GOG: COG4603     Description: GALACTOSIDE TRANSPORT SYSTEM PERMEASE PROTEIN MGLC Gene: BMEII0700     GI: 17989045     BI number: BMEII0700     GOG: COG4603     Description: GALACTOSIDE TRANSPORT SYSTEM PERMEASE PROTEIN MGLC Gene: BMEII0701     GI: 17989046     BI number: BMEII0701     GOG: COG1079     Description: RIBOSE TRANSPORT SYSTEM PERMEASE PROTEIN RBS            Gg   A       A  t G  G      T  g C  C      A  g A  A       Cg C  T       Cg GC       |  a GC        Gc AT        Tg CG        Ta AT        Gt        at G  |       Ta       t  g C  |       Cg       a  t A  |      C  c      c  c G  |      T  g       gc A  |      A  |       ta A  |       Cg        gt C  |       Gc        gc G  |      A  g       cg C  |      G  |       gc AT        Cg        gt CG        At        cg GC        Cg        gc GC        Gc        at                         ttcttttgggcttttcaagagcgggcttgctggataaagtcgctcaaaaatactttggggaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3845 ABC-type uncharacterized transport systems, ATPase components ... can be seen here [R] COG4603 ABC-type uncharacterized transport system, permease component ... can be seen here [R] COG4603 ABC-type uncharacterized transport system, permease component ... can be seen here [R] COG1079 Uncharacterized ABC-type transport system, permease component ... can be seen here     ..................................................................................................................