                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-19.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAGCTTTTCGACGAACTTCTGGCCGATGAAGAAGGCCATATCGACTTCCTTGAAAC
CCAGCTCGACCTTCTCGCCAAGATCGGCGAAGAACGCTATGGCCAGCTTAACGCGGCG
CCCGCCGACGAAGCTGAGTAAgcctgtttcaatctgtcttgaaagccggggcgcatcgctccggcattttctttggcagcatttt
caaaccgctgcgacaccgcaaaagcgccatccaatctttacctccgcccccttgttgtgataaggcgcgcgcaattttcccaattcgtaaggtattacaA
TG

    BMEII0703 Gene: BMEII0703     GI: 17989048     BI number: BMEII0703     GOG: COG0621     Description: Fe-S OXIDOREDUCTAS CC G  C CG        tg GC       c  t GC       t  c CG        at G  A       at C  C       cg A  G       ta A  |       ta TA        ta TA       |  g CG       |  c GC       |  c AT       g  g        a CG        tg       c  t |  A       cg        gc CG        cg        cg GT        gc        gc G  A      A  g       gt T  |      A  c       gc A  |      T  a       gc TA       G  |       cg Cg        At        cg Gc        Gc        gc                         attttctttggcagcattttcaaaccgctgcgacaccgcaaaagcgccatccaatctttacctccgcccccttgttgtgataaggcgcgcgcaattttcccaattcgtaaggtattacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0621 2-methylthioadenine synthetase ... can be seen here     ..................................................................................................................