Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=59 nt.     Delta G= -9.25 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-11.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCAGGACGATTGGCATTCGCCCCGAACATCTTTCTGTCAGCCGCGAGAGCGGAACGTG
GAAAGGCAAGGTCATCCATGCCGAGCATCTGGGTGCCGATACGATCCTCTATGTCGAG
ACAGAAACGGCAGGTCTTGTCACTGCCCGCCTGTTCGGTGAGCAGCACTATAATGAAG
ATGATGTGATCTTCCTCACCCCGGAAGAAGGCAAGACCCATCGTTTCGATGAGGCAGG
CAAAGCGATCCGCTGAtcttctttggcataatcccacaattgaaaaccgcgcctgaccggcgcggtttTTG

    BMEII0749


Gene: BMEII0749     GI: 17989094     BI number: BMEII0749     GOG: -------     Description: hypothetical protei


           tt
          c  c
          t  t
           At
           Gt
           Tg
           Cg
           Gc
          |  a
          |  t
          |  a
          |  a
  T       |  t
T  T      |  c
 GC       |  c
 CG       |  c
 TA       |  a
 AT       |  c
 CG       |  a
|  A      |  a
 CG       |  t
 CG       |  t
A  C      |  g
G  A      |  a
A  G      C  a
A  |      C  a
 CG       T  a
 GC       A  c
|  A       Gc
|  A       Cg         a
G  A       Gc       g  c
A  G      A  |      t  c
A  C      A  |       cg
G  G      A  |       cg
A  A       Cg        gc
 AT        Gc        cg
 GC        Gc        gc
 GC        At        cg
 CG        Cg        cg
                        tttTTG


    ..................................................................................................................