                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:   Size=73 nt.     Delta G=-20.09 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAAaaagcgcaggccacgggcggcagtcgcgggggcgcgccgcccgtatcttttcaactttatagacgcatcattttacaagcggtgtcattcacgcg
aaggtaaatctgccgcatgtcttggatgtggaggaggtttctttggcgcgcatgccggagcataatccggccgagtgaaatgagcagcgataggttatgc
tgcaaagaggaaaggtcggagcacggatctcattcatccagatcgaaatgcgccctgaccggcgagattgcgacagatacacctgattccggctgaatat
gcGTG

    BMEII0753 --- BMEII0752 Gene: BMEII0753     GI: 17989098     BI number: BMEII0753     GOG: COG1175     Description: SORBITOL/MANNITOL TRANSPORT INNER MEMBRANE PROTEIN Gene: BMEII0752     GI: 17989097     BI number: BMEII0752     GOG: COG0395     Description: MALTOSE TRANSPORT SYSTEM PERMEASE PROTEIN MAL at t  a t  g t  a c  c a  g a  c c  a t  t t  c t  a t  t c  t t  t at ta        aa gc       g  g c  a       cg c  a       gt cg       c  a gc       a  | cg       c  | cg        ta gt        ta         t cg        at       c  t gt       c  c      t  g c  c      t  |      g  g g  a       gt        ta gt        tg        at gt        gc        cg gc        gc        gt |  a       cg        cg gc        gc        cg cg       a  a      g  a gc        at        tg cg        cg        cg ta        at        ta                         ggtttctttggcgcgcatgccggagcataatccggccgagtgaaatgagcagcgataggttatgctgcaaagaggaaaggtcggagcacggatctcattcatccagatcgaaatgcgccctgaccggcgagattgcgacagatacacctgattccggctgaatatgcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1175 ABC-type sugar transport systems, permease components ... can be seen here [G] COG0395 ABC-type sugar transport system, permease component ... can be seen here     ..................................................................................................................