                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-20.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-21.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATATTAAGCAGGGACAAACAATGACAGCACCGATGGTGAAGTTGCAGAAGGCGCAC
AAAAAGGCGGAGATGAAGAAATTAGAGAAGGCGCACAAGAAGCACTAAgcttctttactattcc
ctccccgatccctgatagcctcttgcattcagggatcgatatccgggccactgcttcgctaatccctcaggattttccgaagcagtggtcttttcatgtg
cttcatcactacacatacttgccggaaaatgattgacggccatattctcttctgacgggcaaattcaggaagaggatcATG

    BMEII0787 Gene: BMEII0787     GI: 17989132     BI number: BMEII0787     GOG: COG3189     Description: PUTATIVE UROPORPHYRIN-III C-METHYLTRANSFERAS   c t  t c  t cg gc a  a       cc t  t      g  a       tc at        gc       c  a gc        gt        cg ta        cg        cg cg       c  c       ta cg       t  t       at cg       a  |       at ta       t  |      |  t at        at       t  t gc        gc       c  c cg        cg        gc |  a      |  c       cg |  t      |  t       ta c  a      |  a       ta c  t       ta        cg c  c       at        gc t  c       gc        ta cg        gc        cg cg        gc        at cg        at        cg                         gtcttttcatgtgcttcatcactacacatacttgccggaaaatgattgacggccatattctcttctgacgggcaaattcaggaagaggatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3189 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................