Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-14.37 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-17.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGGCGTGATGATGTCTATGCTTTTGATGGCAAGGACTGGAAGGTGGCCGGCAAGCT
GCCGCGCGGTCTGGCCTATGGCGCAGCCTTCGATGCGCCGGGCGGTCTTCTGGTCGTG
GGCGGTGAAGATAGAGACGGCAAGGCCCGCAAGGAGGTTTTCCTCCTCAAATGGGATG
GCAAGGCCCTCTCGGTCGAAAACTGActtcgcagtggaaagagcgcttccatcgataccatttaaaccggaagcgttcttt
ttttgaaagcttggcgacgatgcttctttgcgttattgttccaaaATG

    BMEII0855


Gene: BMEII0855     GI: 17989200     BI number: BMEII0855     GOG: -------     Description: hypothetical protei


  A
A  G
 CG
 GC
 GC
T  C
 AT
 GC
 GT        tt
 GC       c  c
T  |      A  g
A  |       Gc
A  |       Ta
A  |       Cg        ca
C  |       At       c  t
T  |      A  g      a  t
 CG       A  |      t  t
 CG       A  |      a  a
T  T      G  |      g  a
C  C       Cg       c  a
 CG        Ta       t  c
 TA       G  a      a  c
 TA       G  |       cg
 TA       C  |       cg
 TA        Ta        ta
 GC        Cg        ta
 GT        Ta        cg
A  G       Cg        gc
G  A      C  c       cg
 Gc        Cg        gt
 At        Gc        at
 At        Gt        gc
                        tttttttgaaagcttggcgacgatgcttctttgcgttattgttccaaaATG


    ..................................................................................................................