                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:33 nt.    Distance to gene:160 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-20.10 kcal/mol
Antiterminator:    Distance from promoter:28 nt. Size=19 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAT-gataat. It has a score value of 66.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAATTCAATTGAtggctggtcgataatagctggttttgggcttagagcgcgttccggcatcgcacaaagctgcctcttcgggcagctt
tgtcgtttttcggcatcctttttcccatactcgaaatgcaagcgcagttaaaaccatcttgcaatcatttcggctatgtgaaactaattgacttgtagga
tatccattatcggtaaggttagctgaaatgaaactcgtattcttcggggttggccattggcattcggggATG

    BMEII0866 --- BMEII0865 Gene: BMEII0866     GI: 17989211     BI number: BMEII0866     GOG: COG0673     Description: OXIDOREDUCTASE Gene: BMEII0865     GI: 17989210     BI number: BMEII0865     GOG: COG0673     Description: 1-CARBOXY-3-CHLORO-3,4-DIHYDROXYCYCLO HEXA-1,5-DIENE DEHYDROGENAS   a t  g t  a cg gc g  g gc tg t  t t  t t  | gc                  tt gc                 c  c tg                  tg cg                  cg gc                  cg a  |                 gc t  |        a        ta a  |      c  a       cg a  |      a  a       gc ta        cg        at at        gc        at gc       c  |       at cg       t  |       cg t  c       at        at g  a       cg       c  | gc        gc        gc ta        gc        cg                         tttttcggcatcctttttcccatactcgaaatgcaagcgcagttaaaaccatcttgcaatcatttcggctatgtgaaactaattgacttgtaggatatccattatcggtaaggttagctgaaatgaaactcgtattcttcggggttggccattggcattcggggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0673 Predicted dehydrogenases and related proteins ... can be seen here [R] COG0673 Predicted dehydrogenases and related proteins ... can be seen here     ..................................................................................................................