                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:151 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-17.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAACACAAACTTGTGACGGATGGCCTCTATCGTTATGTGCGCCATCCGATGTATCT
GTCATTCTGGCTCTGGGCAATTGCGCAGTTTTTCCTGTTGCCCAACTGGATTGCGGGC
CTCGCCGGGCTTCTCGGGGTTGCGATTCTTTATTTCTATCGGATCGAACATGAAGAAG
CGATGATGCGGGAGGCTTTCGGTTCTGCCTATGACGAATATTCCAGCCGCATCGGCCG
TATCATTCCCAAACCCTGGTAAatccgctgctgccgaaacagacaggatgaatcgccgcagcctgcttTTG

    BMEII0989 Gene: BMEII0989     GI: 17989334     BI number: BMEII0989     GOG: COG3319     Description: hypothetical protei CC G  C TA TA GC T  T CG CG TA T  | T  | T  | T  |                 CT GT                 G  T AT                  GC CG                  GT GC                 C  | CG                 C  | G  G                 GC T  |                 CG T  |                 TG A  |                 CG A  |                 CG CG                 G  | GC                  GT GC                  GT GT        GC        CG T  C      C  C       GC C  |       TG        TG T  |       CG        TA CG        CG        AT GC        GC        GT GC        GT        GC                         TTTATTTCTATCGGATCGAACATGAAGAAGCGATGATGCGGGAGGCTTTCGGTTCTGCCTATGACGAATATTCCAGCCGCATCGGCCGTATCATTCCCAAACCCTGGTAAatccgctgctgccgaaacagacaggatgaatcgccgcagcctgcttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG3319 Thioesterase domains of type I polyketide synthases or non-ribosomal peptide synthetases ... can be seen here     ..................................................................................................................