                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:130 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.60 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAACGGCGCCGATCGGCACTTCGCCGCGTTCACCGGCGGCGTGCGCTTCTTCAAGCGC
GATATCCATCGGCGTGGCGCTGTTAGCCTTTGTGATGCTCGCCGCTTTTCGCATGGGG
TCCCATTTCGTGTATTGTTCGGGAAATTTCGCTCGCAAGCCATGGAGTGATTTGTTAC
TGCATAATTCCCGAAATCGAAACCGATTTGCGAACGGAATTATACGGCGTTCCTGTTG
CGAATAACCTTTGGCGTGCAAtgatggcgcaaggtgacgcggtaacgctgctgaaaggcctatatcagATG

    BMEII1039 --- BMEII1038 Gene: BMEII1039     GI: 17989384     BI number: BMEII1039     GOG: COG1187     Description: TRNA PSEUDOURIDINE SYNTHASE A Gene: BMEII1038     GI: 17989383     BI number: BMEII1038     GOG: COG0742     Description: METHYLTRANSFERAS             T           T  G           A  T           T  T            GC            TG           G  G            CG            TA            TA            TA            AT           C  T           C  T        C   C       C  C      G  C C  C       TG       A  A TA        GC        AT GT        GT        CG G  T       GC       G  | G  T      |  G       CG GC        GC        TA TG        TA        CG AT       A  A       GT CG        CG        CG GT        GC        TA                         TTTGTTACTGCATAATTCCCGAAATCGAAACCGATTTGCGAACGGAATTATACGGCGTTCCTGTTGCGAATAACCTTTGGCGTGCAAtgatggcgcaaggtgacgcggtaacgctgctgaaaggcctatatcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1187 16S rRNA uridine-516 pseudouridylate synthase and related pseudouridylate synthases ... can be seen here [L] COG0742 N6-adenine-specific methylase ... can be seen here     ..................................................................................................................