                                                                        Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.30 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaagtacttttgtgttcaggaatgtttaagaataaagagttgcagtagattcggtatattttatcgaagctgcagatgctctatataaatagaagaataa
tttaaatgaggaaagcccggataggatattctatccgggcttttttataatattattacaattctggatttatagaaaaattttttacgtgatatttgga
tcagtttagatatggcgttaaaaatttgtaatgttgcatgccatgaacaatatttgatttcagttggctgttttattccggcaaaatgtgggaagccttt
TTG

    BMEII1041 Gene: BMEII1041     GI: 17989386     BI number: BMEII1041     GOG: COG3038     Description: CYTOCHROME B56             g           a  a           a  a           g  t           a  a            ta            at            at            at            ta           a  a            ta            at   t       t  | a  t       cg t  t       ta at        cg ta       g  g gt       t  a gc       a  a cg       g  | ta       a  | ta       c  | a  |      g  | g  |       ta a  |       cg        ta tg        gc       a  t gc       a  c       gt at       a  c       gc cg       g  g       at gc        cg        ta ta        ta        at |  g       at        gc |  a       ta        gc |  t       tg        cg tg        tg        cg gc        ta        cg at        at        gc gc        ta        at at        at        at                         ttttataatattattacaattctggatttatagaaaaattttttacgtgatatttggatcagtttagatatggcgttaaaaatttgtaatgttgcatgccatgaacaatatttgatttcagttggctgttttattccggcaaaatgtgggaagcctttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG3038 Cytochrome B561 ... can be seen here     ..................................................................................................................