Gene putatively regulated by attenuation in B_melitensis_II

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=2 nt.   Size=17 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gggactacgaacattttcaggggcggggatgcagttttattgcgccctgcctctttattcctgcaaagctcgttgctaaaagcgagcccatgatgacgga
ctttcggcttatcatgacggccatacgaattattggcccggcctcccgctttgcctgatcggctggtttgcacagccaattttctgggtaatttgcggcg
tggaggtccgggatcgaccggctgtgctccaacagtcccctgctatcgttgattcattcgcccgcaaattcagttcgggcatcacaggcaaataccgatc
ATG

    BMEII1043


Gene: BMEII1043     GI: 17989388     BI number: BMEII1043     GOG: COG0060     Description: ISOLEUCYL-TRNA SYNTHETAS


            c
          t  c
          c  c
           cg
           gc
           gt
          c  t
          c  t
           cg
           gc
           gc
          t  |
          t  |
           at
           tg
           ta
 aa       a  |
g  t       at         t
c  t       gc       t  g
a  a       cg       t  c
t  t      a  g      g  a
 at       t  c       gc
 cg        at        ta
 cg        cg        cg
 gc        cg        gc
 gc        gt        gc
                        aattttctgggtaatttgcggcgtggaggtccgggatcgaccggctgtgctccaacagtcccctgctatcgttgattcattcgcccgcaaattcagttcgggcatcacaggcaaataccgatcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0060 Isoleucyl-tRNA synthetase ... can be seen here

    ..................................................................................................................